Complexity Improbability and Design

[Furrowed Brow]

In the debate Winning Life’s Lotteries 4gold made the following point:

Complexity is special because it is a method by which we use to determine whether a phenomenon is random or designed.

Question 1: Is it too improbable to believe that some complex natural phenomena do not require a designer?

Question 2: Are improbability and complexity two measures by which we can validly conclude a designer.

[The Duke of Vandals]

Improbability and complexity by themselves are not all that telling, you need a third ingredient in this mix and I propose that we introduce 'purpose'.

Purpose only exists in our minds. It's whatever we want it to be and has no bearing on the external universe.

A standard deck of playing cards has 52! different combinations. So the chances of any one of those combinations coming up after a random shuffle are immensely remote.

Are you familiar with the anthropic principle? In it's simplest terms, it states that large chances are mitigated by a larger number of instances.

For example, if I shuffle the 52 card deck and expect a specific combination, the chances of getting a specific combination are X. However, if I keep shuffling the cards, X increases. 2x for two shufflings. 3x for three shufflings and so on.

Basically, a one in a million chance isn't a problem if we have 10 million chances.

And yet when I buy a new deck of cards they are always in the same order, so I would be tempted to say there was a creator at the card factory who always sorts the cards into this pretty pattern much like a snow flake or crystal.
Then I discover that a simple set of rules, as in solitary, that tends to make the cards come up in this same order. (even though most of the time you come up stuck without a move)
But we can't conclude that there is a designer yet because both of those scenarios lack purpose.

Purpose has nothing to do with it.

The reason we can't assume a designer is that a designer can never be a long term answer. The only reason you're looking for a designer is because you see intelligence and complexity in nature. Well, wouldn't a designer also be intelligent and complex? The designer either requires a designer or a tremendous cop-out.

Even though the order of the stacked deck looked random, it had a purpose for being the way it was and it is that purpose that implies a creator.

To be sure, purpose is simply a human perception. Your implication that purpose is in any way tied to the external world is a fallacious leap of logic... and more than a little disingenuous & arrogant. When we look at the universe we see that it's utterly and completely toxic to us save for a tiny spec of land on one planet. Even our own planet is largerly uninhabitable by us as it's 75% covered by salt water with at least one continent too cold to support large scale human settlement. If we approach this state of affairs honestly and invoke purpose, we can only conclude that a creator doesn't particularly care for us... that we've been tossed onto a tiny planet with no means of interstellar travel and only empty space should we be able to leave.

Cars, boats, planes all have a purpose and a designer. Rocks, beaches, crystals, snowflakes have no immediate purpose and we know that they are the creation of the simple laws of physics and chemistry.

To illustrate the arbitrary nature of purpose, look at cars, boats, and planes. Their purpose is whatever you want to assign them. The intended purpose of a car is a wheeled conveyance, but it can also be a weapon, a form of art, a shelter, a music theatre, a conference room, a venue for sexual intercourse, a source of income, a thing of pride... it can be many of these things at once or none of them. It can have multiple purposes at once.

The idea that there is some set-in-stone purpose for a car that exists beyond our minds is silly. It simply does not exist.

It's even sillier for non-fabricated things, like universes or life forms (do NOT get me started on the Loa Loa worm...).

[olavisjo]

Are you familiar with the anthropic principle? In it's simplest terms, it states that large chances are mitigated by a larger number of instances.

For example, if I shuffle the 52 card deck and expect a specific combination, the chances of getting a specific combination are X. However, if I keep shuffling the cards, X increases. 2x for two shufflings. 3x for three shufflings and so on.

Basically, a one in a million chance isn't a problem if we have 10 million chances.

52! is about 8.0658 X 10^67, if you shuffled the cards a million trillion trillion times per second on every star system in the universe since the beginning of time you would have about 52! combinations. Don't get me started on the human DNA.

The reason we can't assume a designer is that a designer can never be a long term answer. The only reason you're looking for a designer is because you see intelligence and complexity in nature. Well, wouldn't a designer also be intelligent and complex? The designer either requires a designer or a tremendous cop-out.

We do not understand the laws that our creator exists in, by analogy it is like a book trying to understand its author by the laws that govern literature. God is not governed by time, but we can't comprehend what life without time would be like. To you this may sound like a cop-out, but what is it when you put of the creation of the universe from nothing until science can gather more evidence to explain this contradiction of the laws of physics that says mater and energy can not be created or destroyed?

To be sure, purpose is simply a human perception. Your implication that purpose is in any way tied to the external world is a fallacious leap of logic... and more than a little disingenuous & arrogant. When we look at the universe we see that it's utterly and completely toxic to us save for a tiny spec of land on one planet. Even our own planet is largerly uninhabitable by us as it's 75% covered by salt water with at least one continent too cold to support large scale human settlement. If we approach this state of affairs honestly and invoke purpose, we can only conclude that a creator doesn't particularly care for us... that we've been tossed onto a tiny planet with no means of interstellar travel and only empty space should we be able to leave.

Are you going to tell the God that created the universe that he can't give us a means of travelling from one part of his creation to another?

To illustrate the arbitrary nature of purpose, look at cars, boats, and planes. Their purpose is whatever you want to assign them. The intended purpose of a car is a wheeled conveyance, but it can also be a weapon, a form of art, a shelter, a music theatre, a conference room, a venue for sexual intercourse, a source of income, a thing of pride... it can be many of these things at once or none of them. It can have multiple purposes at once.

The idea that there is some set-in-stone purpose for a car that exists beyond our minds is silly. It simply does not exist.

It's even sillier for non-fabricated things, like universes or life forms (do NOT get me started on the Loa Loa worm...).

If the nature of purpose is so arbitrary, why is it that when I assign those purposes to rocks and logs, I don't get to work on time?
Even the Loa Loa worm has a purpose, all the things God created has a purpose.
Jesus came across a man born blind and they asked him why. Jesus said it was to show the power of God. So Jesus spit on the ground and made mud with his saliva and smoothed the mud over the blind man's eyes and told him to go was it away and he did see.
Today if medicine restores a blind persons vision they will still be blind because they will still not see God, but when Jesus heals our blindness we will see God.

[steen]

Jesus came across a man born blind and they asked him why. Jesus said it was to show the power of God. So Jesus spit on the ground and made mud with his saliva and smoothed the mud over the blind man's eyes and told him to go was it away and he did see.
Today if medicine restores a blind persons vision they will still be blind because they will still not see God, but when Jesus heals our blindness we will see God.

Another fundie who doesn't understand the meaning of the word "blind." What you are saying is that these people are blind unless that have the same views as YOU. Highly narcissistic and presumptuous.

[byofrcs]

Are you familiar with the anthropic principle? In it's simplest terms, it states that large chances are mitigated by a larger number of instances.

For example, if I shuffle the 52 card deck and expect a specific combination, the chances of getting a specific combination are X. However, if I keep shuffling the cards, X increases. 2x for two shufflings. 3x for three shufflings and so on.

Basically, a one in a million chance isn't a problem if we have 10 million chances.

52! is about 8.0658 X 10^67, if you shuffled the cards a million trillion trillion times per second on every star system in the universe since the beginning of time you would have about 52! combinations. Don't get me started on the human DNA.

......

Mindless numbers. The allusion to the human DNA sounds like the usual strawman. Forget human DNA - that is trivially small compared to some amoeba DNA which are over 200 times the size.

That is an aside. If I use a genetic algorithm to select shuffling then, as with anything in genetics, the use of a suitable fitness mechanism allows for much faster convergence to a solution than random selection.

I have no idea what Jesus is being referred to in this forum section - there are no contemporaneous records of Jesus so please try and keep such fanciful musings to the other forum sections unless you can provide some evidence that Jesus actually existed at all. (The Bible is not evidence !).

[micatala]

Are you familiar with the anthropic principle? In it's simplest terms, it states that large chances are mitigated by a larger number of instances.

For example, if I shuffle the 52 card deck and expect a specific combination, the chances of getting a specific combination are X. However, if I keep shuffling the cards, X increases. 2x for two shufflings. 3x for three shufflings and so on.

Basically, a one in a million chance isn't a problem if we have 10 million chances.

52! is about 8.0658 X 10^67, if you shuffled the cards a million trillion trillion times per second on every star system in the universe since the beginning of time you would have about 52! combinations. Don't get me started on the human DNA.

If the implication is that 'chance' development of DNA is impossible, then this analysis is lacking. There are several problems.

One is the implicit assumption that the formation of any particular DNA or other self-replicating molecule is just as likely as any other. In the card-shuffling analogy, we assume we shuffle the cards so that any configuration is just as likely as any other. This is not necessarily the case with combinations of atoms into molecules. These combinations depend on the laws of chemistry. Some bonds or combinations are going to be more likely than others.

A second problem is that we always start the shuffling from a blank deck. Evolution or self-replication does not necessarily proceed that way. In your analogy, if we don't get the 'right' configuration when shuffling the cards, we then start over. However, evolution might proceed by first picking out cards of the same suit that happen to end up adjacent to each other. This pair would then stay together into the next shuffling, and possibly pick up another card of the same suit. In this way, we could accumulate those changes 'favored by the environment' to get a deck with the suits sorted out.

Your analogy ignores this effect.

THirdly, your analogy assumes that only the one 'perfect' configuration is the right one. In the analogy with DNA, this assumes that only DNA exactly as it exists today could be the basis for life. However, it is possible that DNA could have evolved differently, leading to different kinds of life than we see today. It is even possible that we could have substantial differences in DNA and still have organisms which look substantially the same. From what we know, a lot of our DNA is 'junk.' It is possible we could make huge changes to this junk, or even jettison it, and still have DNA that would produce a human being. This means there is not one out of the 52! or whatever possibilites that are 'right', but possibly a large fraction of the 52!.

You need to consider that alternative configurations could be just as right 'functionally' to the one we have now, even if it looks different at the molecular level.

To illustrate the arbitrary nature of purpose, look at cars, boats, and planes. Their purpose is whatever you want to assign them. The intended purpose of a car is a wheeled conveyance, but it can also be a weapon, a form of art, a shelter, a music theatre, a conference room, a venue for sexual intercourse, a source of income, a thing of pride... it can be many of these things at once or none of them. It can have multiple purposes at once.

The idea that there is some set-in-stone purpose for a car that exists beyond our minds is silly. It simply does not exist.

It's even sillier for non-fabricated things, like universes or life forms (do NOT get me started on the Loa Loa worm...).

If the nature of purpose is so arbitrary, why is it that when I assign those purposes to rocks and logs, I don't get to work on time?
Even the Loa Loa worm has a purpose, all the things God created has a purpose.
Jesus came across a man born blind and they asked him why. Jesus said it was to show the power of God. So Jesus spit on the ground and made mud with his saliva and smoothed the mud over the blind man's eyes and told him to go was it away and he did see.
Today if medicine restores a blind persons vision they will still be blind because they will still not see God, but when Jesus heals our blindness we will see God.

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

[olavisjo]

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

So when you are walking through the woods and you see some 'sticks' holding up a tent, you would conclude these are not manufactured tent pegs but only natural sticks therefore there is no evidence that an intelligent designer has camped out here.
I am not asking anyone to see things according to my point of view, but if I tell you that I can see God everywhere that I look and you say you can't see him anywhere, then either you are blind or I am a liar or I am delusional.

[Cathar1950]

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

So when you are walking through the woods and you see some 'sticks' holding up a tent, you would conclude these are not manufactured tent pegs but only natural sticks therefore there is no evidence that an intelligent designer has camped out here.
I am not asking anyone to see things according to my point of view, but if I tell you that I can see God everywhere that I look and you say you can't see him anywhere, then either you are blind or I am a liar or I am delusional.

I hardly think blind, a liar or delusional are the only alternatives. You may be the one that is blind or you may very well be projecting what ever image you have of God unto everything with some little "god filter" or god complex going on. We don't even know by what you mean by "seeing" "God" in "everything" and all the other personal or shared meanings you might hold. I see no reason to jump to one of your selective conclusions based on so little.

[jamesearl]

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

So when you are walking through the woods and you see some 'sticks' holding up a tent, you would conclude these are not manufactured tent pegs but only natural sticks therefore there is no evidence that an intelligent designer has camped out here.
I am not asking anyone to see things according to my point of view, but if I tell you that I can see God everywhere that I look and you say you can't see him anywhere, then either you are blind or I am a liar or I am delusional.

*looking at bolded part*, well, no insult intended, but yeah.


You seem to look at the world in a scewed view. The world is not this way because of US, but WE are the way we are BECAUSE of the world. Do you understand what i mean?

[micatala]

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

So when you are walking through the woods and you see some 'sticks' holding up a tent, you would conclude these are not manufactured tent pegs but only natural sticks therefore there is no evidence that an intelligent designer has camped out here.
I am not asking anyone to see things according to my point of view, but if I tell you that I can see God everywhere that I look and you say you can't see him anywhere, then either you are blind or I am a liar or I am delusional.

I am a believer in God as well. I certainly consider what we see around us to be ultimately attributable to God. However, I view evolution as part of Gods creation, as one of the mechanisms of His creation, just like the law of gravity, the laws of chemistry, or quantum mechanics.

I am also not saying there is no such thing as design. However, you are infering design where there are perfectly reasonable 'non-design' explanations and no evidence for design other than "I don't see how this could not be intentionally designed". Subjective determinations of what is designed and what are not are not particularly reliable.

Just look at what DNA looks like. We can denoted it by a string of letters

AACTGAGGTCACCTGAGATACCTGT . . .

If you look at this, it looks just like a scrambled deck. It might as well be a shuffled deck (or thousands or millions of decks all shuffled together) where we only keep track of the 4 suits. A 'designed DNA' would look more like

ACTGACTGACTGACTG . .

or

AAAAAAATTTTTTTGGGGGGGCCCCCCC . . . .

In addition to confusing function with purpose, I think ID proponents confuse structure with design.

A snowflake has an incredibly complex structure. Anyone looking at a magnification of a snowflake could be forgiven if they thought it was designed. It is more complex than a lace doily or embroidery done by one of my aunts. However, the structure is the result of completely random processes which are constricted by the simple laws of chemistry.

There is no 'intelligence' or 'design' of a particular snowflake, except perhaps in that the underlying laws of chemistry and physics might reflect the intelligence or planning of a creator.

[achilles12604]

I think you are confusing purpose with function.

I might be out camping and have forgotten or lost my tent pegs. I find some short sticks lying around that are strong enough to 'serve the purpose.' However, these sticks had no 'intended purpose' at all. I have merely been able to employ them so that they can function as tent pegs.

The same is true of animals or plant products we use for food or other 'purposes.' We are simply looking at things from our own anthropromorphic point of view if we tell ourselves the purpose of these things is to feed and cloth us, etc. However, as with my stick tent pegs, just because we have used these things to fulfill a particular function, does not mean that these functions were their intended purposes.

So when you are walking through the woods and you see some 'sticks' holding up a tent, you would conclude these are not manufactured tent pegs but only natural sticks therefore there is no evidence that an intelligent designer has camped out here.
I am not asking anyone to see things according to my point of view, but if I tell you that I can see God everywhere that I look and you say you can't see him anywhere, then either you are blind or I am a liar or I am delusional.

I am a believer in God as well. I certainly consider what we see around us to be ultimately attributable to God. However, I view evolution as part of Gods creation, as one of the mechanisms of His creation, just like the law of gravity, the laws of chemistry, or quantum mechanics.

I am also not saying there is no such thing as design. However, you are infering design where there are perfectly reasonable 'non-design' explanations and no evidence for design other than "I don't see how this could not be intentionally designed". Subjective determinations of what is designed and what are not are not particularly reliable.

Just look at what DNA looks like. We can denoted it by a string of letters

AACTGAGGTCACCTGAGATACCTGT . . .

If you look at this, it looks just like a scrambled deck. It might as well be a shuffled deck (or thousands or millions of decks all shuffled together) where we only keep track of the 4 suits. A 'designed DNA' would look more like

ACTGACTGACTGACTG . .

or

AAAAAAATTTTTTTGGGGGGGCCCCCCC . . . .

In addition to confusing function with purpose, I think ID proponents confuse structure with design.

A snowflake has an incredibly complex structure. Anyone looking at a magnification of a snowflake could be forgiven if they thought it was designed. It is more complex than a lace doily or embroidery done by one of my aunts. However, the structure is the result of completely random processes which are constricted by the simple laws of chemistry.

There is no 'intelligence' or 'design' of a particular snowflake, except perhaps in that the underlying laws of chemistry and physics might reflect the intelligence or planning of a creator.

\
Just to let you know, I haddn't thought about the difference between structure and design. A light bulb went off in my head after this. Thought I would let ya know.