Why Intelligent Design Isn't a Scientific Theory

[Jacurutu]

Intelligent design is not a scientific theory for several reasons.

1) Any scientific theory must falsifiable. This means that it has to be something that can be tested and proven wrong if it is indeed wrong. There is no means of doing this with the "theory" of intelligent design.
2) Any scientific theory must be parsimonious, in the sense that it must be the simplest and most realistic explanation. Now, I know that many people might say that it doesn't get more simple than saying "God created everything." However, based on scientific observation, does it seem more probable that the universe and all living things were spontaneously generated at once or that modern life is the result of the processes of natural selection and random mutation over the last three billion years? We can rule out the first simply by the chemical law that mass and energy are neither created nor destroyed (although they may be interchanged). The second possibility is supported by mounds of empirical evidence.
3) Any scientific theory should allow you to make predictions. With evolution, you can do this; with intelligent design, you cannot.
4) Any evidence must be reproduceable. There are countless experiments testing the tenets of evolutionary theory; for example, you could test random mutation by inducing mutation in yeast with UV radiation (the same radiation that comes from our sun) and observing the phenotypic variation after plating these samples and allowing colonies to grow. Likewise, you can induce mutation in more advanced animals and observing the phenotypic effects of those mutations. The results of these tests will be consistent over time. The other bases of evolution are quite testable and reproducable as well.

Anyway, I've seen plenty of people claim that evolution and intelligent design are equally viable scientific theories, but intelligent design does not meet the qualifications to be considered a scientific theory.

My question is: how do people still want to call ID a scientific theory and teach it alongside evolution when one is faith and the other is a true scientific theory?

[Confused]

My question is: how do people still want to call ID a scientific theory and teach it alongside evolution when one is faith and the other is a true scientific theory?

Because without having an intelligently designed scientific theory, no intelligence nor design in the brain can be accounted for or be said to exist according to Darwin's deluded theory about ape-men.

ID theory on the other hand accounts for the intelligent design of the brain by presupposing that either an intelligent process or an intelligent being purposely designed and either constructed or created intelligently designed brains.

Unfortunately for convoluted evolutionary theorists, they think their brains intelligent but not intelligently designed.

In other words, God of Gaps. When did Darwin suggest ape-men? Do you assume this because he links man and ape with a common ancestor? Men and women share a common ancestor. Is this deluded as well? This link is made on Science nor science fiction. Read up on DNA. Not only was the completion of the Human Genome Project phenomenal, but based on Darwins theory, they found genetic sequences exactly where he predicted them to be. Keep in mind, the head of this project was not only a highly respected scientist, but also a devout Christian. You can put your head between your legs and pretend that DNA evidence doesnt' exist, or that Carbon dating is wrong, or that it is a great conspiracy but it doens't make it any less true.

Actuallly, the brain is very intelligently designed. The precise manner in which neurons must fire with the precise amounts of myelin sheaths and neurotransmitters etc... is astounding. Here is the thing. If all man was created by on being, then should not all brains be the same? So do neurological disorders exist? Parkinsons, alzheimers, autism, schizophrenia, etc....... Was God having a bad creation day when he created these particular brains, or should we blame it on something the mother or father did, or perhaps the grandparents, or even better, blame the victim.

[Jester]

Please allow me to clarify. I was referring to the formation of the earliest forms of cellular life, which, to my knowledge, is explained within the atheistic paradigm as being due to random events.

Well, as far as I can see, it doesn't appear that is random too. There is chemistry rules that are involved in carbon based reactions. There appears to be the raw building blocks of life all over the universe. Even Titan, which has an atmosphere very similar to what the early earth was thought to be life , has many very complex orangic compounds in it's atmosphere.

There also is the matter of the way that amino acids form chains when aligned on
quartz crystal faces. This forms very simple proteins. All you need to get 'life' kick started is to have one of these protien chains be self replicating (in theory at least).

I’ve not heard the statement about crystal faces guiding protein construction. Thanks, I’ll look into that.
As for the rest of the explanation, I’ll have to disagree. Laws of chemical reaction are insufficient for explaining the origin of life. This is particularly true of the Nucleic Acids, but many parts, as well as the overall construction of the cell have similar issues.
Also, the idea of a protein molecule becoming self replicating is a big “if”. I’ve heard of no compelling evidence for the possibility, let alone the likelihood, of this.

That problem is being addressed now. For example, there is this article from Nature in 1996

Lee DH, Granja JR, Martinez JA, Severin K, and Ghadri MR, 1996 "A self-replicating peptide" Nature, 382:525-8

--------------------------------------------------------------------------------
The production of amino acids and their condensation to polypeptides under plausibly prebiotic conditions have long been known. But despite the central importance of molecular self-replication in the origin of life, the feasibility of peptide self-replication has not been established experimentally. Here we report an example of a self-replicating peptide. We show that a 32-residue alpha-helical peptide based on the leucine-zipper domain of the yeast transcription factor GCN4 can act autocatalytically in templating its own synthesis by accelerating the thioester-promoted amide-bond condensation of 15- and 17-residue fragments in neutral, dilute aqueous solutions. The self-replication process displays parabolic growth pattern with the initial rates of product formation correlating with the square-foot of initial template concentration.
--------------------------------------------------------------------------------

This only addresses the issue of self-replication of peptides. The bulk of my problem was with the apparent impossibility of the formation of the DNA and RNA molecules in any kind of meaningful way (i.e., having a meaningful sequence within the cell into which it is absorbed).

And when it comes to dembski's claims about 'Information'. I don't see how he can test and quantify is claims. He has come up with some "Information Laws" that are nto testable in and of themselves, and then is promoting I.D. based on the assumptions he is calling 'laws' (such as the "law of conservcation of information', when he can't measure or quantify the term information)

You make a good point here. We should look into the testability of these claims. I would add the counterpoint that he did not invent these laws, however. They have traditionally been among the accepted working methods of science in several fields. I am not personally aware of a clear cut test of these concepts, but in all situations of which we do have knowledge, these rules hold to be true. That is a common means of testing within science.

No, his claims about 'information' are not quite a comon means within science. He went far beyond any 'information theory'. .. to the point of speculation. So far, he has not even approched /

Here is a link talking about Dembski and his information theories.
http://www.talkorigins.org/faqs/informa ... mbski.html

And this is one about information theory in general, and how the ID movement is
using it.
http://www.talkorigins.org/faqs/informa ... heory.html

I looked over this argument, and thus far am still uncertain. I make no claim that ID is proven, but do not find this rebuttal compelling.
First, it makes the claim:

There is an infinite number of UTMs to choose from. Given an arbitrary finite string, we can find a UTM on which the Kolmogorov complexity of the string is arbitrarily low or arbitrarily high. Nature has no preference for one UTM over another.

This is incorrect logic. The ID are not advocating an infinite number of UTMs in which nature has no preference for one UTM over another. First, the claim that nature has no influence whatsoever does not apply, and it directly contradicts the (in my opinion, inadequate) argument that natural laws of chemistry have dictated the origin of life. ID supporters have not proposed an infinite number of possibilities, but only noted that chemical laws do not dictate the sequencing order of information bearing molecules, making the probability of their being useful by random bonding “vanishingly small”.

I am willing to admit that I may have missed something, but I found no clear contradiction between ID and the Classical Information Theory. The ID theory has not claimed that “the contents of a string depended on its probability of occurrence” it has claimed that a strings probability of occurrence is partially dependent on the number of alternative strings (i.e. the “reference computer” in Kolmororov complexity). The alternative strings, in the case of the origin of life, does happen to coincide with the length of the backbone of the DNA/RNA molecule (it being the “computer” in this scenario) which has an unthinkably high number of alternatives, and no inherent quality which would cause it to produce meaningful information.
This rebuttal does make a good point in that information patterns preexisting events are not necessarily causes of said events. I fail to see, however, how this relates to the issue. Science agrees that the patterns of DNA/RNA are, in fact, informational causes of the events to which they have been connected.
It is true that we have very little knowledge in the way of the probability of the actual event of the formation of these molecules. What we do have, however, is an “upper limit” imposed by the limiting factors which are unthinkably small. All this proves is that we do not know how much smaller it gets from there.
As for the “law of conservation of information” I do not have much information for or against, but to say that, thus far, the ID theory hardly seems to stand or fall on it.

[Jose]

Also, that begs the question “who or what created the aliens?”

It does indeed. Science would say they arose the same way the rest of us did. ID folks would say god did it.

The fact that a theory is difficult to disprove should not discredit it. Now, I’m not asserting that ID is correct. I’m still undecided myself. If I reject it outright, however, I want it to be because I’ve seen some way in which it’s assumptions or logic are shown to be incorrect.

Indeed, what converts a hypothesis into a theory is its inability to be disproven after many tests. But, ID doesn't qualify as a theory. It has no evidence. And, as you request, its assumptions and logic have been shown to be incorrect. This has been discussed in other threads; we'll see if we get to the critical parts here--though I touched on them in my prior post.

More importantly, a theory is derived from the evidence. It's not built first, and then a bunch of minions go out looking for anything that might seem to fit it. In this case, it's not even a matter of what's simplest or what's most probable. The evidence points clearly and unambiguously at evolution. There's no evidence at all that gods exist. Their strongest argument for existence is that they hide so well that they can never be found.

I’m actually going to disagree with your basic stance here. In an ideal world, all theories would be derived from evidence, but this is not the case in the reality of science. A hypothesis must usually be formed before all of the evidence is available (as it precedes the experiment/observation process). While failure to adjust the hypothesis when evidence contradicts it is folly, some very highly respected laws and theories were formed long before there was anything like sufficient evidence to support them (such as the theory of relativity, and, by modern standards, much of the law of gravity).

Hypotheses are formed on the basis of what evidence is available. An hypothesis is a "tentative explanation of the data." The term is mis-used in K-12 science teaching to mean "predictions," but in reality, the hypothesis is the tentative explanation of the data.

Naturally, people try to interpret what they see, with whatever information is available. Even religions (at least the older ones) classify as first-level hypotheses, explaining the observations according to the information available at the time. But, to graduate from "hypothesis" to "theory," the hypothesis must be tested a lot, and survive the tests. Most theories must be modified as time goes on, but occasionally some are discarded altogether (e.g. "phlogiston").

As I don’t really ascribe to the belief that evolution and the existence of God are diametrically opposed, I’m probably not going to give this as much attention as most would feel it deserves. Enough to say that, scientifically, it has not passed all the tests thrown at it, and is continually being adjusted to match the evidence. With this, I am not referring exclusively to details; we have some major troubles that we’re still trying to work out.

Again, you'll have to give actual examples. I'll suggest real examples, and not the silliness that has been discredited many times, promulgated by Jonathan Wells at the instigation of his Father, the Rev. Sun Young Moon. Nonetheless:

Why do textbooks claim that the 1953 Miller-Urey experiment shows how life’s building blocks may have formed on the early Earth--when conditions on the early Earth were probably nothing like those used in the experiment, and the origin of life remains a mystery?

He's being specifically obtuse and misleading here. Note that he says the "experiment shows how life's building blocks may have formed..." What's wrong with that? The experiments show precisely that. They may have formed under such conditions. Was the early earth exactly the same as Miller and Urey's experimental conditions? Probably not (and Wells says "probably" also, which means he accepts that there is still the possibility that they actually were.) Have subsequent experiments under conditions we think more appropriate been done? Yes. Is there any fundamental difference in the answer? No. The point of the experiment, and the point of putting it in textbooks is to say natural conditions can produce life's building blocks. By saying may, the texts acknowledge that it may not have worked that way--but we can no longer say "it's impossible." And so what if we don't know all of the details, and they remain "a mystery"? Don't we kinda have to work from the information we have, rather than pretend that none of it exists, and say "god did it"?

My Response in Outline:
• Most biology textbooks include the origin of life--and the Miller-Urey experiment--in their treatments of evolution. If the NCSE feels that the origin of life is really “not a question about evolution,” the organization should launch a campaign to correct biology textbooks.

The textbooks present the Miller-Urey experiment under the heading of "origin of life." Creationists misleadingly insist that it's a part of "evolution." Even so, the experiment is of historical importance--and most State Science Education Standards include a bit of historical perspective.

• Because the Miller-Urey experiment used a simulated atmosphere that geochemists now agree was incorrect, it was not the “first successful attempt to show how organic molecules might have been produced on the early Earth.” When conditions are changed to reflect better knowledge of the Earth’s early atmosphere, the experiment doesn’t work.

Uhhh...think about what you quoted from NCSE? The experiment still works. Indeed, many other experiments have been done that show even more impressive chemistry occurs without divine intervention--like assembly of nucleotides into RNA molecules, and assembly of amino acids into polypeptides, and the ability of some of these to self-replicate. Again, I note that you, too, say "might." This is very different from claiming that the experiment shows how it actually occurred.

If the origin of life “remains a vigorous area of research,” it is only because origin-of-life researchers are dedicated to their work, not because they have discovered anything that demonstrates how life originated.

Have you read much of what they've published recently? They've discovered a great many things. Of course, we're still at the stage of developing hypotheses from the data, rather than being at the theory stage. But that's still a lot more information than the ID folks have, which is a speculation that's been kicking around for thousands of years with no information at all about it.

I agree with this wholeheartedly, and believe that it was perfectly reasonable to believe in the Theory of Evolution at the time Darwin proposed it. But I disagree with some fairly basic assumptions of evolution that have been overturned since then (such as the fact that evolution has been unable to explain the origin of life in light of the relatively new discoveries of it’s complexity and the Cambrian Explosion).

If you read science instead of Wells, you'll see that these are non-problems. Complexity is entirely explained by ordinary, garden-variety evolution. The Cambrian Explosion is simply the result of animals developing shells, so there was something to fossilize. The older fossil assemblages (such as the Ediacaran) are precursors to the Cambrian life. But, without hard parts, they were very unlikely to become fossilized. Neither complexity nor the Cambrian fossils are issues.

Now, this is not to say that, if evolution is not accurate, we must automatically conclude that God must have created all life. That is not scientific in the slightest, and many apologists miss this point. It is my love for science, not God, that is bothered by the assertion that evolution is obvious fact. I believe that we should find a better scientific, rather than religious, theory to replace it.

The place to start here is to look at the data, and develop a scientific theory to explain it (pardon me, hypothesis...tests will determine whether it moves to the rank of theory). It doesn't work to read the misleading claims of anti-evolution propagandists--any more than it works to read the conclusions of evolutionists. You have to look at the actual data. It's a big chore, though, since we have over 150 years' worth of scientific papers that present the data.

The difficulty (I think) you are experiencing reflects the difficulty of presenting the data in science classes. There's too much, so the tradition has been to teach science "as a rhetoric of its conclusions." When presented as "facts," science loses much of its interest--and conclusions that people object to on religious (evolution) or political (global warming) grounds become the focus of controversy. It's very sad. If we could all look at the data, it would be pretty clear what's going on.

I also agree that the proponents of ID are claiming that it covers the same material, but this is the main point on which I am uncertain. I think they might be talking at cross purposes with the evolutionists. Nor am I convinced that they are right, and will not accept their theory as true unless I become convinced that it is scientific (my current opinion is mostly not with a few gems that might turn out to be much more scientific than I had first believed).

Let me come back to this later...it requires an analysis of the data on which ID is based.

The origin of life is not a part of the theory of evolution. It's its own separate field, called the origin of life. Evolution specifically deals with the change of life over time, which pretty much requires that life exists before evolution can occur.

Fair enough. I apologize for treating the two theories as one. My basic suggestion (that ID, in theory, could overturn some aspects of evolution while leaving others untouched) remains possible so far as I can see.

Great. You'll see why the NSCE said what they did about Wells' comments on the Miller-Urey experiments. Wrong field. Of course, anti-evolutionists pretty much have to attack the origin of life, rather than evolution itself, simply because the latter is so well understood.

They don't understand macroevolution (which turns out to be microevolution involving different genes, or microevolution over a longer time, depending on whose definition you use).

I would not go that far. Many, assuredly, do not understand evolution, and I can see how it is very tempting to say this (I’ve faced the same temptation on numerous occasions). To say that all who disagree or hold a specific theory clearly do not understand is dangerously close to a dismissive and judgmental statement. I can understand the possibility, but think that should be supported if you wish to make the claim.

Excellent. First, I don't make the blanket statement that they "don't understand evolution." I claim they don't understand "macroevolution," as defined in two different ways. The first is " changes in morphology." People always say evolution doesn't make sense because we never see wings grow out of the back of a sheep, or a dog turning into a bear (or other sorts of things). These sorts of comments indicate that they don't know the current state of molecular embryology. Wings, for example, develop from limb buds, just like arms and legs do. The genes that control their development are the same genes--hox, shh, fgf, etc. There has never been, to my knowledge, a mutation that enables limb buds to form on the back, or on segments between those that normally have limb buds. Apparently, this disrupts embryonic development too much (those segments would also end up developing the spinal structure of shoulders or hips, which wouldn't work well where lungs are supposed to be). To summarize, not having said much, there's a lot of molecular biology that one must have a handle on to understand the changes in morphology that occur through changes in genetic information. Most people don't understand how it works because they haven't studied the molecular biology.

The second interpretation of macroevolution is the pattern--as you mention here:

Getting more to your actual point, I would argue that it is oversimplified to the point of being untrue that macroevolution is microevolution involving different genes, or microevolution over a longer time. There are very specific problems that are involved in the development of new Orders, Classes, and Kingdoms than cannot be addressed with the principals of microevolution.

Microevolution has been proven with things like genes that control pigments, or beak shape, or other "minor" traits. Obviously, changes in the frequencies of different pigment-controlling genes cannot account for the differences between present-day fish and present-day horses. So, the culprits must be different genes. What genes would they be? Well, if there are morphological differences, then they must be genes that control morphology--the Master Control genes as they are coming to be called. So, we're back to the morphology discussion above.

But we can't just look at current fish and current horses and say "gosh, they're different." We have to work our way back. Horses have a fossil record, which goes back eventually to small browsers. They were pretty close to "generic mammals." Beyond that, we have the mammalian adaptive radiation that occurred after the dinosaurs went extinct. That radiation occurred over a short time of only 10 million years, so we don't have a lot of fossils. Nonetheless, during the time of the dinos, mammals were pretty close to "generic mammals"--and their fossils go back about 250 MY. At that time, fish, looked pretty much like fish as we know them, but different species. Let's keep working back. In the late Permian, it'd be hard to find "mammals," and it would be hard to find "dinos." There are things that look like they might be able to give rise to either, but mostly there are are amphibians--no decent reptiles. Fish are kinda odd looking, too.

Now...at this point, the life that existed on earth did not have "fish" and "horses" as we know them, but odd-looking fish and odd-looking amphibians. Let's move back a bit more, to the Mississippian and then Devonian. The early Pennsylvanian had no amphibians, but did have weird sorts of things that lived in water, had arms and legs with 8 digits, and mostly used their legs to push themselves around in the water. The Mississippian had guys with less robust limbs. Going back into the Devonian, we find guys with less and less robust limbs, and come eventually to guys whose limbs are fairly short, and they use them primarly to swim.

What are fish like? Well, what we know now are guys with lots of "rays" in their fins. Going back to the Devonian, we find the "rays" tend to have some bony stuff at the base. The farther back we go, the more substantial this bony stuff is. In the Silurian and earliest Devonian, we're hard-pressed to tell the "fish" from the "amphibians" in that they are all living in water, and they all have the same types of limbs: bony stuff at the base with rays extending out into the fins.

Now we can talk about the diversification of fish from horses. Their common ancestor had generic limbs, with bones at the base and rays at the end. The guys that lived in open water, over the millennia, accumulated mutations that stopped development of the bony parts at the base, and that improved development of the rays in the fins. They became the ray-finned fish we know now. The guys that lived in swampy places (in what is now Greenland) had stuff to push through. The mutations that happened to helpful were ones that grew their limb-bones bigger, and that blocked development of the rays. After a few tens of millions of years or so, we've got two populations, one that looks like "fish" and one that looks like "almost-amphibians."

And so it goes. Populations are split into subgroups, and different subgroups living in different places follow different evolutionary paths. Once they've become different enough, through ordinary microevolution, that they cannot interbreed, they can never again share genes. The fish diversified into a bazillion different kinds. The amphibians diversified into another zoo of different kinds--at least one of which acquired one or more mutations that enabled it to put an outer layer around its eggs and lay them on land. That kind gave rise to a new diversification of land animals, etc, etc, etc.

Obviously, in the earliest days of the fish/amphibian split, all we had was a diverse fish population, with various fin morphologies. But, over time, and with later diversity, we eventually ended up with things that we think are different enough to call them families, orders, and classes. For Kingdoms, you've got to go back rather farther.

I agree that science is limited to the study of the natural world, and am generally skeptical about the idea that science will ever really provide data for the existence of anything supernatural. I do, however, believe that science (like all other studies) is defined by arbitrary definitions that do not coincide perfectly with the real world. I merely wanted to point out that there may be some overlap, and that we seem to be looking for that overlap in the current era. Forgive me if I have implied more than this.

The question of overlap is an interesting one, all right. As a scientist, I can best describe how I work--and that's by starting with data. I'd be quite happy if god would reveal himself, but he hasn't done so. On the other hand, the data continuously and repeatedly reveal what I call "the footprints of evolution." Evolution is so fundamental a part of Life that it is permeating understanding in more and more fields--particularly medicine.

The thing is, we only have methods for assessing what exists in measurable space-time. Things outside of measurable space-time are defined as "supernatural," and by their own definition cannot be measured by mere "natural" methodology.

Now...why would science restrict itself to such methodology? The answer is quite simple: to assure objectivity and replicability. To be valid, results of investigations must be replicable. People who report things that no one else can repeat are eventually revealed (by science, not by religion) as mistaken, or as "overly optimistic" in their conclusions, or outright deceitful. There are enough examples of each that I'll avoid naming names. The desire for replicability has the casualty of eliminating the supernatural. The desire for explanations to be tied strictly to the data also tends to eliminate supernatural explanations.

Where we stand now, it's unclear whether the supernatural, or "spiritual world" even exists. A recent report described studies of peoples' brain activity during spiritual experiences (meditation, or talking in tongues)...suggesting a means of testing the hypothesis that the "spiritual world" is entirely produced within an individual's brain.

One of the rules of science is that one should not trust one's observations as valid unless they are reproducible. When n=1, no theory and no predictions can be made. However, in this case, even n=1 is far greater than we have at present. All we have now is competing stories from ancient civilizations.

I don’t have much problem with this response, except to say that experiences can, in theory be valid without being reproducible. We cannot call such experiences scientific on the ground that we cannot test and understand them, but they are scientific on the ground that they happened. Truly, this is a major part of the difficulty in drawing any conclusions about the origin of species, the origin of life, or the origin of the universe. These are cases of events that are not practically reproducible, and are therefore extremely difficult to make observations and predictions about. Of course, I do believe that it is useful to make the attempt, but here we get into a blurry line about what the rule of reproducibility means on a practical level.

As with evolution, these are topics where it isn't reasonable to think of reproducing the phenomenon under investigation. Nor is it reasonable to reproduce Katrina or Hawaii's 1946 tsunami in order to investigate their causes, their effects, and methods of mitigating the damage of a possible repeat. The necessity is to reproduce and validate the measurements upon which to develop understanding--plate tectonics, ocean pressure-sensing, etc in the case of tsunamis, and measurements of the microwave background of interstellar space, in the case of the universe.

The nature of the "observations and predictions" might be illustrated with evolution. On the basis of Darwin's ideas, and with the re-discovery of Mendel's work, and with the discovery of mutation as the source of genetic variation, it was possible to make a prediction. The prediction is not that "evolution should do this next," but that "If Darwin's suggestion of descent with modification is true, and if evolution accounts for the pattern of life on earth (varieties, species, genera, families, etc) then we should find, if we had the technology that DNA sequences of species show the same relationships as do the species themselves based upon morphological similarities." This was a clear prediction of Darwin's theory, and it was borne out by experiment. It forms one of the tests of evolutionary theory, and has since been incorporated into the growing pile of evidence that supports the theory. Given that the only way we know for genes to get from parent to offspring is by normal mating and having kids, it seems inescapable that the DNA sequence relationships reveal genetic relationships, and therefore common descent (ie, macroevolution).

...If there's a designer, said designer should have a motive, and that's unfathomable. Hence, no predictions.

I don’t have much argument with the basic claims here. That might indeed be the crippling blow to ID. The only reservation I have is that the ability to make predictions really seems to be more a matter of the practical application of science than the scientific study of the universe. That is to say that, on this particular point, ID is stripped not really of its credibility so much as of its function in technological development, ecological policy, etc.

We need to clarify "prediction." We don't speak of predictions in the sense of revealing what the future holds. We speak of predictions in the sense of "if this theory is true, then..." some set of observations should also be true, or some experiment should produce a particular result, or some such. As noted above, "if Darwin's descent with modification idea was right, then DNA sequences should be related ... if we can figure out how to sequence DNA." When we learned how to sequence DNA, evolution became an inescapable reality for many scientists who were unconcerned before.

Of course, sometimes we can make predictions about the future--and we are trying to concerning global warming, and the decimation of the world's fish stocks, and the disastrous use of antibiotics in animal feed that's caused the rise of antibiotic-resistant pathogens. Alas, those who stand to make money from the status quo claim it's all "politics."

I would argue, however, that the tenets of evolutionary theory are not as reproducible as the evolutionists claim. The yeast mutations that occur when bombarded with UV rays which was mentioned in the OP is only reproducible if scientists use a specific range of UV rays. If the entire breadth of UV radiation present in sunlight is used, the low frequency waves inhibit the process. As for the existence of different species as evidence that mutation is random, this is circular logic, as it must presume that the species of earth are the result of evolution in order to reach this conclusion.

Again, it's necessary to look at all of the data. UV light is a preferred method of inducing mutations in yeast for genetic studies. Obviously, one uses the wavelength that is best absorbed by DNA, and not wavelengths that DNA does not absorb. Needless to say, to reproduce a result, one must reproduce the methods--otherwise, it's not the same experiment.

As for sunlight, there is ample evidence that the sun's UV is mutagenic--both using yeast as the test organism, and using humans as the test organism. That's why we're supposed to wear sunscreen to decrease our risk of skin cancer.

As for the randomness of mutation, the data are from direct measurement. Usually, it's direct measurement from exposing bacteria or yeast (or DNA) to conditions that are known to induce mutations, then isolate DNA from different individuals, and sequence a particular region to see what's changed. A less tedious way is to "saturate" a gene with mutations that cause phenotypic changes, then sequence the mutants--which usually shows randomness, except in regions that are tolerant of changes (in which case you don't find mutations that cause phenotypic changes).

It's from the measurements and from the known chemistry of DNA that we conclude "randomness." We then apply this understanding to evolutionary theory. If oxygen radicals mutate DNA at random in the lab, it's very hard to see how they can choose which gene they want to hit out in the world.

While it is undeniably true that random collision of molecules won't create the human genome, no one but the creationist/ID folks pretend that evolution works that way. Evolution works by modification of what already exists. (That's why the origin of life and the evolution of life are different fields of study.)

Perhaps I am simply missing something, then. Please let me explain and answer a question.

With this statement, I was referring to the origin of life theory (combined the two again; that doesn’t make me look good). It is a problem for our current concept of the origin of life that the structure of information bearing molecules cannot be formed by rules of chemistry and retain their ability to bear information. This is problematic in that such molecules would have to be extremely complex without any rule of nature to guide them. Given this, we seem to be stuck back at random chance, though even it seems to ignore the requirement of complexity on such a molecule.

I have heard it argued that, in every other area of science, it is acceptable to conclude intelligence at the discovery of an information bearing system (such as ancient writing). I am not to the point of advocating this myself, but do want to discuss/study the idea before automatically concluding that it is unscientific.

Again, this is one of those areas where most people don't know enough of the data, and thus don't follow the logic (ie, understand the whole story). "The structure of information bearing molecules cannot be formed by rules of chemistry" refers to the molecules that currently-living things use. They've had several billion years of evolution, to tweak and fine-tune what they have. Let's think back again...the earliest self-replicating molecule was not a living cell. It could have been just a few bases, joined together somehow, with the reaction catalyzed by the surface of silica particles in clay. We know--because the experiment has been done--that if we start with a simple self-replicating molecule and let it replicate, then mistakes occur (mutations), and some of the variants replicate better. These out-compete the others. In time, we get more complex self-replicating molecules.

That's a start. It "may" relate to how life originated. It certainly relates to evolution: start with something simple, and something complex can arise. Start with something, and modifications of that something will lead to different things. As the complexity increases, as the modifications are themselves modified, we eventually get to a point where it's hard to see how the self-replicating thing (or living thing) could possibly have arisen by all of its parts flying together at random. Well, they didn't.

While I am not yet decided, I will argue that this is not what Dembski’s arguments have claimed. The argument is that, when shuffling the cards, the arrival at any combination that can sustain itself biologically is vanishingly small, coupled with what is a generally accepted argument in other forms of study (complex information is the result of intent).

The fact that all life on Earth has a similar structure, on this point, would be evidence (though in no way proof) that there were not a great number of possible forms life could have taken, and we came out by random chance by this one. That would hardly explain why all cells have such similar structure unless there was a very limited number of practically creatable cells which had the ability to survive indefinitely. As such, we would be back to Dembski’s “vanishingly small” numbers.

Turn around the argument. If life arose through ordinary chemistry, starting with something really simple as I suggest above, and if it became what it is now by garden-variety evolution as we know it, we would have the sequence of the human genome, and the sequence of the sunflower genome, etc. We'd have what we have, entirely independent of the probability of having exactly the same thing happen again, and independent of the probability of any particular sequence being biologically viable. It happened once, and we got the result we got. Dembski's calculation is the probability of the same thing occurring again, or to caricaturize what he says, having evolution aim at George W. Bush since the very beginning, with GWB's genome being the Complex Specified Information that evolution was trying to create.

It's silly because there's no mechanism for creating anything in particular. There's a mechanism for changing DNA, but not for choosing what changes to make.

I both agree and disagree. I love the idea that we cannot throw the word God at something that we simply do not understand, but do feel that you have missed my basic point. What we know about information bearing objects thus far is that any natural law that might assemble them destroys their ability to retain unique order (thus, contain information). Selection may explain the development of existing Nucleic Acids, but it cannot be applied to the creation of such molecules.

No, the natural law that assembles nucleic acids does so by copying a pre-existing nucleic acid. Copying the parent DNA strand retains its information content. Even Dembski knows this. BUT, he's trying to trick people into thinking that DNA arises by a soup of nucleotides coming together all at once--a process that does, indeed, create random sequence. He's also trying to trick people into thinking that the DNA sequences we now have--George W Bush, for example--are the identical sequences we had two billion years ago. The fossil record shows that's nuts. The first sequences were far simpler. The first cells were far simpler. The self-replicating things that preceded the first cells had to be simpler still.

However, the ID folks claim that it is FACT that evolution cannot occur by modification of pre-existing structures. Dembski claims information must come together all at once, and cannot occur through descent with modification. Behe claims complex structures must arise all at once, and cannot occur by modification of pre-existing structures. They categorically rule out evolutionary theory in their "proof" that evolution is impossible. Behe invents "irreducible complexity" as complex structures that don't work if one part is removed. OK, fine. He then states that such structures can never arise by modification of prior, less effective structures. Where does he get this? Well, it's the only way he can "prove" that evolution is impossible, because he can only calculate the probability of things appearing full-blown. Sorry. That's not how genetics works.

Dembski is just as wacky. I'll comment on only a part of what you've quoted:

Further, just as magnetic letters can be combined and recombined in any way to form various sequences on a metal surface, so too can each of the four bases A, T, G, and C attach to any site on the DNA backbone with equal facility, making all sequences equally probable (or improbable). The same type of chemical bond occurs between the bases and the backbone regardless of which base attaches. All four bases are acceptable; none is preferred. In other words, differential bonding affinities do not account for the sequencing of the bases. Because these same facts hold for RNA molecules, researchers who speculate that life began in an "RNA world" have also failed to solve the sequencing problem--i.e., the problem of explaining how information present in all functioning RNA molecules could have arisen in the first place. For those who want to explain the origin of life as the result of self-organizing properties intrinsic to the material constituents of living systems, these rather elementary facts of molecular biology have devastating implications. The most logical place to look for self-organizing properties to explain the origin of genetic information is in the constituent parts of the molecules carrying that information. But biochemistry and molecular biology make clear that the forces of attraction between the constituents in DNA, RNA, and protein do not explain the sequence specificity of these large information-bearing biomolecules.

Do you see where he's gone wrong already? He's pretended that there's no way to maintain a DNA sequence. "All bases can attach to the backbone with equal facility." Well, they could if the chemistry worked that way, but it doesn't. The backbone isn't lying around waiting for bases to jump on. The backbone and base are added together, chosen by virtue of their pairing with the complementary base on the other strand.

He misleads us in pretending that "functioning RNA molecules" of several billion years ago functioned precisely as they do now. There's no reason to make this assumption, and many reasons to reject it. The science of origins posits simple nucleotide combinations and self-replication, as I mentioned above. He's got it wrong. Of course, he has to--no one would buy it if he said it's impossible for simple self-replicating molecules to self-replicate, and over a billion years become a little more complex.

The problem with his "specified complexity" is that he can't define it. Initially, it was the target that his archer aimed at, in his archer-and-target analogy. Later, it became defined as "identifiable because the probability of getting it by chance is nearly zero." Let's see how well this works: which of these is "specified complexity"?

Sequence 1:gtgcaggtctcagaacagtcatgatggcgtctgtaatttgtgacagtgttttggtaaccgggtcaaacaggg

Sequence 2:gatgcaagactccagaacttggaaaatatggttcacatactttctcctggatatcctaataagtcgttcaaca

One is part of the alcohol dehydrogenase gene. The other is gibberish (and can be completely deleted from the yeast genome with no effect at all). Both are equally explainable by evolution. Only one is explained by ID--but the operational definition used by ID can't tell 'em apart. They are equally complex, with equal probabilities of coming together at random, but one has information content, and the other appears to have none.

Funny...Dembski never talks about the sequences for which genetic analysis shows there is no function. They kinda destroy his argument. They also tell us that we have to imbue the intelligent designer with a sense of humor.

[Confused]

Jester:

Just a few updates:
Ancient Repeitive Elements (ARE's) arise from "jumping genes" which are capable of copying and inserting themselves in various other locations in the genome, usually without any functional consequences. Mamallian genomes are littered with ARE's. When one aligns sections of the human and mouse genomes, anchored by the appearance of gene counterparts that occur in the same order, we can usually identify ARE's in approx the same location of the two genomes. Because most of these remain in the same position, it is most consistent with their having arrived in the genome of a common mammalian ancestor, and having been carried along ever since. Unless one is willing to say God placed these decapitated ARE's (by transpositioning them, such as ID asserts) just to confuse and mislead us, the conclusion of a common ancestor is impossible to escape. That is simply related to DNA proof:

Now, why isn't ID a scientific theory: it fails to qualify as one. All scientific theories must represent a framework for making sense of a body of experimental observations. But the primary utility of a theory is not to just look back, but forward. A viable scientific theory predicts other findings and suggests approaches for further experimental verification. This is impossible for ID. It doesn't even provide a mechanism in which the postulated supernatural interventions would give rise to complexity. Recent revelations about the poster child for ID, the bacterial flagellum has undercut the ID postition that individual subunits for the flagellum could have had no prior useful function of some other sort, therefore the motor could not have been assembled in a step wise faction, driven by natural forces. Newest research shows comparison of protein sequences from multiple bacteria has demonstrated several components of the flagellum are related to an entirely different apparatus used by certain bacteria to inject toxins into other bacteria that they are attacking. This is a clear example of survival of the fittest as well as the possibility that elements of the structure were duplicated millions of years ago, then recruited for new uses-the motor functions.

All this information is in "The Language of God" by Richard Collins (Head of the human genome project and Christian).

[Jose]

Jester--

...Now, why isn't ID a scientific theory: it fails to qualify as one. All scientific theories must represent a framework for making sense of a body of experimental observations. But the primary utility of a theory is not to just look back, but forward. A viable scientific theory predicts other findings and suggests approaches for further experimental verification. This is impossible for ID. It doesn't even provide a mechanism in which the postulated supernatural interventions would give rise to complexity...

Well said. I'll see if I can write something briefly for a change:

The Basics of ID:

1. We do not have a complete description of the history of (...insert favorite example here, such as bacterial flagellum...) therefore, we'll say the gaps we don't know are the work of a designer.
2. Complex structures fail to work if one piece is knocked out; since all of the pieces would not suddenly appear at once and fit together perfectly based on random chemical reactions, we'll say these structures are the work of a designer.
3. Complex information is complex; since all of the nucleotides in the human genome would not suddenly come together all at once in the right order based on random chemical reactions, we'll say these structures are the work of a designer.

Entirely independent of the errors of logic and the false model of evolution assumed here, these are all one-shot answers. All lines of reasoning conclude with "we'll say there's a designer." Saying there's a designer provides no framework for further understanding. Saying there's a designer provides no framework for understanding how unique AREs happen to be in the human and chimp genomes (or is it all great apes? I can't remember) in the same locations, but not in the genomes of any other animals. Why would the designer pop in some AREs in all mammals, and then pop another group just into great apes?

If the answers to all such questions are "the designer wanted to," well....we don't gain much understanding.

Remember, in the good old days (to which ID proponents want to return us), diseases were caused by the designer wanting some people to get sick. Epidemics were caused by the designer being mad at the whole city. Locusts were sent by the designer to punish the unfaithful. And, to use modern examples, the designer sent Hurricane Katrina to New Orleans to punish the US for harboring homosexuals, and the designer is sending global warming as a sign of the End Times (and therefore, instead of doing something about it, all we need to do is pray). If we blame everything on the designer, and make no effort to understand things ourselves, we're pretty much at the mercy of our surroundings. However, if we ask whether there might be natural causes for some of the things we observe, then we might have insights that enable us to make the world a better place.

[Jester]

Indeed, what converts a hypothesis into a theory is its inability to be disproven after many tests. But, ID doesn't qualify as a theory. It has no evidence. And, as you request, its assumptions and logic have been shown to be incorrect. This has been discussed in other threads; we'll see if we get to the critical parts here--though I touched on them in my prior post.

Fair enough, let’s get to them then, and see whether or not I agree.

Hypotheses are formed on the basis of what evidence is available. An hypothesis is a "tentative explanation of the data." The term is mis-used in K-12 science teaching to mean "predictions," but in reality, the hypothesis is the tentative explanation of the data.

This does not discredit my basic point, that scientists on all sides of this (and every) debate are emotionally attached to their theories and come in with prejudices. I do not deny that the creationists and the ID supporters have such prejudices. I feel, however, that it is dangerous to assume that the proponents of evolution/origin of life theory and other naturalistic explanations do not have similar attitudes.

But, to graduate from "hypothesis" to "theory," the hypothesis must be tested a lot, and survive the tests. Most theories must be modified as time goes on, but occasionally some are discarded altogether (e.g. "phlogiston").

Agreed. I’m not firm anywhere yet, but my current leaning is toward the attitude that neither ID nor evolution and origin of life deserve the title theory.

Again, you'll have to give actual examples.

That is entirely fair, I’ll dig around and ask you some questions.

Why do textbooks claim that the 1953 Miller-Urey experiment shows how life’s building blocks may have formed on the early Earth--when conditions on the early Earth were probably nothing like those used in the experiment, and the origin of life remains a mystery?

He's being specifically obtuse and misleading here. Note that he says the "experiment shows how life's building blocks may have formed..." What's wrong with that? The experiments show precisely that. They may have formed under such conditions. Was the early earth exactly the same as Miller and Urey's experimental conditions? Probably not (and Wells says "probably" also, which means he accepts that there is still the possibility that they actually were.) Have subsequent experiments under conditions we think more appropriate been done? Yes. Is there any fundamental difference in the answer? No. The point of the experiment, and the point of putting it in textbooks is to say natural conditions can produce life's building blocks. By saying may, the texts acknowledge that it may not have worked that way--but we can no longer say "it's impossible." And so what if we don't know all of the details, and they remain "a mystery"? Don't we kinda have to work from the information we have, rather than pretend that none of it exists, and say "god did it"?

I agree with most of your claims here, particularly your philosophy: that “God did it” should never replace science. I agree that this does not disprove the possibility, but merely casts a bit of doubt on it. Perhaps this is a good time to give you a specific question. I have read that, while some frequencies of ultraviolet light radiation aid certain biotic processes, the full radiation spectrum in sunlight is harmful to life, particularly as delicate a biotic situation as the formation of early cells. This is typically not a problem, due to the ozone layer of the upper atmosphere. However, the presence of oxygen has been shown to nullify the Miller-Urey experiment. Have you personally heard anything that would explain how life might have formed in spite of this problem?

Have you read much of what they've published recently? They've discovered a great many things. Of course, we're still at the stage of developing hypotheses from the data, rather than being at the theory stage. But that's still a lot more information than the ID folks have, which is a speculation that's been kicking around for thousands of years with no information at all about it.

I skipped most of this outline because I liked your basic arguments. I’d assert that the “ID folks” are arguing regarding information systems, rather than on theological grounds (though they’ve made their reasons clear enough, I believe we should keep the distinction in mind). Beyond that, you make good points. Agreed.

If you read science instead of Wells, you'll see that these are non-problems. Complexity is entirely explained by ordinary, garden-variety evolution. The Cambrian Explosion is simply the result of animals developing shells, so there was something to fossilize. The older fossil assemblages (such as the Ediacaran) are precursors to the Cambrian life. But, without hard parts, they were very unlikely to become fossilized. Neither complexity nor the Cambrian fossils are issues.

Okay, I’ll check that one out. While I do, let me add a couple of more to the list.
1. What do you think of the fact that the evolutionary stance makes the prediction that life should grow in complexity over time, but that the most complex phyla is found in the Cambrian period, rather than being a later development?
2. Would you give me a comment on this quotation?: “A naturalistic model would predict a multitude of transitional forms among tiny- bodied, simple life-forms, vastly outnumbering those among large-bodied, complex life.” It is based on the claim that shorter life span and larger populations should increase the rate of evolution in smaller bodied animals, but that the fossil record shows the opposite.
3. General question: What is the age of life on Earth, according to what you have read? Also, what is a realistic time-frame for species evolving to the state they have reached today.

Now, this is not to say that, if evolution is not accurate, we must automatically conclude that God must have created all life. That is not scientific in the slightest, and many apologists miss this point. It is my love for science, not God, that is bothered by the assertion that evolution is obvious fact. I believe that we should find a better scientific, rather than religious, theory to replace it.

The place to start here is to look at the data, and develop a scientific theory to explain it (pardon me, hypothesis...tests will determine whether it moves to the rank of theory). It doesn't work to read the misleading claims of anti-evolution propagandists--any more than it works to read the conclusions of evolutionists. You have to look at the actual data. It's a big chore, though, since we have over 150 years' worth of scientific papers that present the data.[/quote]I 100% agree with this spirit. My trouble is that I have come to believe that I will always be reading one bias or another. It sometimes feels that sifting through the biases is the only thing harder than sifting through the data.

Most people don't understand how it works because they haven't studied the molecular biology.

I will admit that I do not; I have not studied it nearly enough. My issue with microevolution explaining macroevolution is that there are many traits which are, admittedly, very genetically useful but would be worthless or a hindrance in its transitory phase. To that end, I would claim that, while there must be some scientific explanation of such developments, long-term microevolution driven by natural selection does not seem to be that explanation.

I did not want to irritate everyone by reposting your full explanation of macroevolution. My basic response is that I agree that this does account for some problems, but I am left with the issue of development of certain aspects (such as the caterpillar’s ability to become a butterfly involving several interdependent genes, not a process that could be explained through the force of natural selection) as well as the fact that the fossil record does not show the tree of life in the same way we have categorized it. There is an end to which we are classifying a species as older than another because it fits with this theory, which is perfectly acceptable if the theory has been shown to be true, but is definitely circular logic if we are trying to establish its truth.

The thing is, we only have methods for assessing what exists in measurable space-time. Things outside of measurable space-time are defined as "supernatural," and by their own definition cannot be measured by mere "natural" methodology.

I completely agree with this. I have always felt that this is the major point that both creation “scientists” and atheists who wish to use science to “disprove” the existence of the supernatural seem to miss. I’m delighted to know someone else agrees on this point.

We need to clarify "prediction." We don't speak of predictions in the sense of revealing what the future holds. We speak of predictions in the sense of "if this theory is true, then..."

That is true. My comment did not address predictions by the correct definition. I suppose, then that the major prediction of ID would be that we would find that life has not had a consistent pattern of growth in terms of complexity.

Again, this is one of those areas where most people don't know enough of the data, and thus don't follow the logic (ie, understand the whole story). "The structure of information bearing molecules cannot be formed by rules of chemistry" refers to the molecules that currently-living things use. They've had several billion years of evolution, to tweak and fine-tune what they have. Let's think back again...the earliest self-replicating molecule was not a living cell. It could have been just a few bases, joined together somehow, with the reaction catalyzed by the surface of silica particles in clay. We know--because the experiment has been done--that if we start with a simple self-replicating molecule and let it replicate, then mistakes occur (mutations), and some of the variants replicate better. These out-compete the others. In time, we get more complex self-replicating molecules.

This is definitely an explanation worth studying, though I’m not as convinced of this one as many are. So far, this seems highly unlikely at best. Basically, I have not been convinced that the Earth is old enough for this process to have occurred.
Going on a bit of a tangent would you mind commenting on this quotation as well?
“Many accounts of the origin of life assume that the spontaneous synthesis of a self-replicating nucleic acid could take place readily. Serious chemical obstacles exist, however, which make such an event extremely improbable. Prebiotic syntheses of adenine from HCN, of D,L-ribose from adenosine, and of adenosine from adenine and D-ribose have in fact been demonstrated. However these procedures use pure starting materials, afford poor yields, and are run under conditions which are not compatible with one another. Any nucleic acid components which were formed on the primitive earth would tend to hydrolyze by a number of pathways. Their polymerization would be inhibited by the presence of vast numbers of related substances which would react preferentially with them. It appears likely that nucleic acids were not formed by prebiotic routes, but are later products of evolution.”

Turn around the argument. If life arose through ordinary chemistry, starting with something really simple as I suggest above, and if it became what it is now by garden-variety evolution as we know it, we would have the sequence of the human genome, and the sequence of the sunflower genome, etc. We'd have what we have, entirely independent of the probability of having exactly the same thing happen again, and independent of the probability of any particular sequence being biologically viable.

I understand this, but still have a bit of a problem here. This presupposes one of two ideas that either only one form did arise in spite of the possibility of others (ID’s “probability” argument) or that others are now extinct. For either of these possibilities to be viable, there would have to be a great many “options” of how life might have arisen. Since there is no real way to test this, we certainly cannot side with the ID supporters who claim that there were no other options. My trouble is that this is back to a world of pure “we don’t know”, which is exactly where I started at. It seems that life is so specified to the forces of the universe in general and conditions of Earth in particular that it would be more logical to conclude that there were few, if any, possibilities for alternative forms of life. It would take a great deal of possibilities, however, to make the rise of complex life probable.

No, the natural law that assembles nucleic acids does so by copying a pre-existing nucleic acid. Copying the parent DNA strand retains its information content. Even Dembski knows this. BUT, he's trying to trick people into thinking that DNA arises by a soup of nucleotides coming together all at once--a process that does, indeed, create random sequence.

I understand the idea that Nucleic acids grow over time, but do not understand what principal causes this increase in complexity before the creation of a cell which is subject to evolution. Thus, the probability of a simple strand of RNA for the earliest cells developing over time would not appear to be much (if at all) higher than the encoding of such a cell developing all at once.

Dembski claims information must come together all at once, and cannot occur through descent with modification. Behe claims complex structures must arise all at once, and cannot occur by modification of pre-existing structures. They categorically rule out evolutionary theory in their "proof" that evolution is impossible. Behe invents "irreducible complexity" as complex structures that don't work if one part is removed. OK, fine. He then states that such structures can never arise by modification of prior, less effective structures.

I understand and agree with this, though I do not yet believe that the basic stance of the ID people is all that far off. The same arguments could be made (with less, but still attention worthy strength) for the earliest, least effective structures of life.


If this transition in points is confusing, know that I cut out the Dembski quotation from this spot.

Do you see where he's gone wrong already? He's pretended that there's no way to maintain a DNA sequence. "All bases can attach to the backbone with equal facility." Well, they could if the chemistry worked that way, but it doesn't. The backbone isn't lying around waiting for bases to jump on. The backbone and base are added together, chosen by virtue of their pairing with the complementary base on the other strand.

I understand that these molecules are self-replicating, but his claim here references to the issue of the creation of the original codes, not the preservation of it. Even if these codes developed over time, there is no existing model explaining how the DNA/RNA “families” with meaningful information was created before the rise of the cell. Certainly, the earliest DNA is simpler than human DNA and operates somewhat differently, but thus far we have brought its production to the point of probability.

Sequence 1:gtgcaggtctcagaacagtcatgatggcgtctgtaatttgtgacagtgttttggtaaccgggtcaaacaggg

Sequence 2:gatgcaagactccagaacttggaaaatatggttcacatactttctcctggatatcctaataagtcgttcaaca

One is part of the alcohol dehydrogenase gene. The other is gibberish (and can be completely deleted from the yeast genome with no effect at all). Both are equally explainable by evolution. Only one is explained by ID--but the operational definition used by ID can't tell 'em apart. They are equally complex, with equal probabilities of coming together at random, but one has information content, and the other appears to have none.

This is a very valid point, and ID supporters need to deal with this, though I would argue that evolution has not yet adequately explained the information bearing sequence in full. It can, of course, explain it in part, but the formation of the original factors of the earliest molecules which made them useful to cells is clearly outside of evolution.

Funny...Dembski never talks about the sequences for which genetic analysis shows there is no function. They kinda destroy his argument. They also tell us that we have to imbue the intelligent designer with a sense of humor.

You are right to say that he should deal with them. (Though, on completely unscientific grounds, I am more than willing to believe that the creator has a sense of humor).

Ultimately, I want to thank you for being so patient to clarify so many points for me. I have a great deal of questions and (as you can see) very much need some dialogue to sort them out.

[Jester]

Jester:

Just a few updates:
Ancient Repeitive Elements (ARE's) arise from "jumping genes" which are capable of copying and inserting themselves in various other locations in the genome, usually without any functional consequences. Mamallian genomes are littered with ARE's. When one aligns sections of the human and mouse genomes, anchored by the appearance of gene counterparts that occur in the same order, we can usually identify ARE's in approx the same location of the two genomes. Because most of these remain in the same position, it is most consistent with their having arrived in the genome of a common mammalian ancestor, and having been carried along ever since. Unless one is willing to say God placed these decapitated ARE's (by transpositioning them, such as ID asserts) just to confuse and mislead us, the conclusion of a common ancestor is impossible to escape. That is simply related to DNA proof:

Now, why isn't ID a scientific theory: it fails to qualify as one. All scientific theories must represent a framework for making sense of a body of experimental observations. But the primary utility of a theory is not to just look back, but forward. A viable scientific theory predicts other findings and suggests approaches for further experimental verification. This is impossible for ID. It doesn't even provide a mechanism in which the postulated supernatural interventions would give rise to complexity. Recent revelations about the poster child for ID, the bacterial flagellum has undercut the ID postition that individual subunits for the flagellum could have had no prior useful function of some other sort, therefore the motor could not have been assembled in a step wise faction, driven by natural forces. Newest research shows comparison of protein sequences from multiple bacteria has demonstrated several components of the flagellum are related to an entirely different apparatus used by certain bacteria to inject toxins into other bacteria that they are attacking. This is a clear example of survival of the fittest as well as the possibility that elements of the structure were duplicated millions of years ago, then recruited for new uses-the motor functions.

All this information is in "The Language of God" by Richard Collins (Head of the human genome project and Christian).

Thank you for this. I don't have time to give you a complete response, but the summary is that Jose and yourself seem to be slowly convining me that you are correct in this position. I've only a few questions left, basically suspect that I'm going to end up back at my original belief - that the concept of the supernatural and science are mutually exclusive fields of study. But thanks for the clear and careful explanation to get me there. I'm grateful.

[Goat]

Indeed, what converts a hypothesis into a theory is its inability to be disproven after many tests. But, ID doesn't qualify as a theory. It has no evidence. And, as you request, its assumptions and logic have been shown to be incorrect. This has been discussed in other threads; we'll see if we get to the critical parts here--though I touched on them in my prior post.

Fair enough, let’s get to them then, and see whether or not I agree.

Hypotheses are formed on the basis of what evidence is available. An hypothesis is a "tentative explanation of the data." The term is mis-used in K-12 science teaching to mean "predictions," but in reality, the hypothesis is the tentative explanation of the data.

This does not discredit my basic point, that scientists on all sides of this (and every) debate are emotionally attached to their theories and come in with prejudices. I do not deny that the creationists and the ID supporters have such prejudices. I feel, however, that it is dangerous to assume that the proponents of evolution/origin of life theory and other naturalistic explanations do not have similar attitudes.

Of course, this does not address the issue that "I.D." does not make predictions, does not have any way to test for it, and does not explain the complexity of life as we see it, except to say 'An intelligent designer (wink wink god) did it'.

But, to graduate from "hypothesis" to "theory," the hypothesis must be tested a lot, and survive the tests. Most theories must be modified as time goes on, but occasionally some are discarded altogether (e.g. "phlogiston").

Agreed. I’m not firm anywhere yet, but my current leaning is toward the attitude that neither ID nor evolution and origin of life deserve the title theory.

I will agree with you about abiogenesis. However, it is much more on the hypothoses stage than I.D. is. There are several competing ideas that CAN be theoritically tested about how the first replicating molecules came into existance.

On the other hand, you vastly understate the evidence for evolution. It has made
many strong predictions that have been validated (antibodic resistant bacteria for one). It is probably the best understood and most highly tested from any scientific theory we have.

[Confused]

Jester--

...Now, why isn't ID a scientific theory: it fails to qualify as one. All scientific theories must represent a framework for making sense of a body of experimental observations. But the primary utility of a theory is not to just look back, but forward. A viable scientific theory predicts other findings and suggests approaches for further experimental verification. This is impossible for ID. It doesn't even provide a mechanism in which the postulated supernatural interventions would give rise to complexity...

Well said. I'll see if I can write something briefly for a change:

The Basics of ID:

1. We do not have a complete description of the history of (...insert favorite example here, such as bacterial flagellum...) therefore, we'll say the gaps we don't know are the work of a designer.
2. Complex structures fail to work if one piece is knocked out; since all of the pieces would not suddenly appear at once and fit together perfectly based on random chemical reactions, we'll say these structures are the work of a designer.
3. Complex information is complex; since all of the nucleotides in the human genome would not suddenly come together all at once in the right order based on random chemical reactions, we'll say these structures are the work of a designer.

Entirely independent of the errors of logic and the false model of evolution assumed here, these are all one-shot answers. All lines of reasoning conclude with "we'll say there's a designer." Saying there's a designer provides no framework for further understanding. Saying there's a designer provides no framework for understanding how unique AREs happen to be in the human and chimp genomes (or is it all great apes? I can't remember) in the same locations, but not in the genomes of any other animals. Why would the designer pop in some AREs in all mammals, and then pop another group just into great apes?

If the answers to all such questions are "the designer wanted to," well....we don't gain much understanding.

Remember, in the good old days (to which ID proponents want to return us), diseases were caused by the designer wanting some people to get sick. Epidemics were caused by the designer being mad at the whole city. Locusts were sent by the designer to punish the unfaithful. And, to use modern examples, the designer sent Hurricane Katrina to New Orleans to punish the US for harboring homosexuals, and the designer is sending global warming as a sign of the End Times (and therefore, instead of doing something about it, all we need to do is pray). If we blame everything on the designer, and make no effort to understand things ourselves, we're pretty much at the mercy of our surroundings. However, if we ask whether there might be natural causes for some of the things we observe, then we might have insights that enable us to make the world a better place.

Thanks for the briefness. Makes it much easier for me to follow. The problems I see with creationism and ID is that creationism falls apart when applied to science and if ID is in fact correct, then we must assume God is constantly having to come in and fix His mistakes. In regards to the human genome falling together in perfect place, well, it doesn't. Mistranslations are done all the time during the transcription and translation phase with lead to mutations. Most mutations are senseless ( in that they don't cause change). Some are mutations of deletion which are usually fatal, and the really rare ones are the mutations that actually provide a species with better functions for survival.

I agree, we shouldn't look for supernatural causes for natural occurences. It leads to progress and enlightenment.

[Confused]

Jester:
While posted to Jose, I would like to add a few things as well if you don't mind:

1. What do you think of the fact that the evolutionary stance makes the prediction that life should grow in complexity over time, but that the most complex phyla is found in the Cambrian period, rather than being a later development?

Which most complex phyla are you referring to. Evolution postulates that species will evolve in a form that makes it a positive adaptation for survival in an environment. In some cases, this may seem as if we are taking a complex organ and simplifying it for a new environment. For example: the appendix. We needed it initally due to the average diet of early man consisting of vegetarian foods. As we now rely less on vegetables as the staple of our diet, and more on meat, the appendix doesn't serve much of a purpose. Evolution would hypothesize that at some point the human body will no longer contain one, it will phase out.

2. Would you give me a comment on this quotation?: “A naturalistic model would predict a multitude of transitional forms among tiny- bodied, simple life-forms, vastly outnumbering those among large-bodied, complex life.” It is based on the claim that shorter life span and larger populations should increase the rate of evolution in smaller bodied animals, but that the fossil record shows the opposite.

I will take a stab at this, the larger the population involved, the slower evolution will occur because of the larger gene pool. The smaller the population, and the more isolated it is, the more narrow the gene pool, so the rate of evolution will actually be faster. It is allopatric speciation. Though I am not sure how the size of the bodied animal plays into it.

3. General question: What is the age of life on Earth, according to what you have read?

It depends on what life you are referring to. Based on fossilized record: only single cell organism appear in sediment that are older than 550 million years old. Then about ths time, a great number of vertebrate organisms that were diverse began to appear (Cambrain explosion), 400 million years ago plant life appeared on dry land (derived from aquatic life forms) 30 million years later, animals had moved onto land (possible aquatic creatures transitioning into land dwelling tetrapods based on fossil record), 230 million years ago dinosaurs ruled the earth until the catstrophic event leading to the catastrophic climate changes and the vast amount of dust in the atmosphere. The first record of "modern" Homo Sapiens appears 195,000 years ago, neanderthals in euope existed until ~30,000 years ago, and "hobbits" from Flores in Indonesia (little people with little brains) existed until as recently as 30,0000 years ago. Genetic analysis, study of human variations, and the fossil records satisify the Convergence of Evidence and points to an origin of modern humans ~100,000 years ago, most likely in East Africa. Genetic analysis also suggest that approximately 10,000 ancestors gave rise to the entire 6 billions humans on earth.

Also, what is a realistic time-frame for species evolving to the state they have reached today

Somewhere around the time land dwelling animals came into existence ~370 million years ago to the first record we have as "modern" homo sapiens ~195,000 years ago. But that is just a guess